Determination of ACTN3 genotype
Background
This protocols is adopted from Schadock et al. (2015)1 and is suitable for determining the ACTN3 genotype.
Materials
- A PCR machine
- Specific primers
Primers used un Schadock et al.
| Primer | sequence | Final reaction concentrations | Volume of 100 uM in 500 ul primer mix |
|---|---|---|---|
| hsACTN3_F1 | CGCCCTTCAACAACTGGCTGGA | 0.5 uM | 10 ul |
| hsACTN3_R1 | GATGAGCCCGAGACAGGCAAGG | 0.5 uM | 10 ul |
| hsACTN3Tif_F2 | CAACACTGCCCGAGGCTGACTG | 0.125 uM | 2.5 ul |
| hsACTN3Cir_R2 | CATGATGGCACCTCGCTCTCGG | 0.25 uM | 5 ul |
Add primers to 472.5 ul nuclease free H2O to make a 4X primer mix.
- PCR master mix
- PCR reactions tubes
Methods
- Extract DNA (from whole blood or muscle)
- Mix sample, master mix and primer mix per reaction in a PCR reaction tube:
| Component | Volume |
|---|---|
| 2X Master mix | 10 ul |
| Primer mix | 5 ul |
| Sample (correspondning to 100-250 ng genomic DNA) | 5 ul |
- Run the PCR reaction
| Time | Temperature | Cycles |
|---|---|---|
| 2 min | 95°C | |
| 10 sec | 95°C | |
| 10 sec | 68°C | 35 cycles |
| 45 sec | 72°C | |
| 2 min | 72°C |
- Run the PCR product on a 2% agarose gel using 2-5 ul of the reaction mix. Use a DNA ladder and H2O as negative control.
Analysis
A R/R genotype produces two bands at 690 and 413 bp. A X/X genotype produces two bands at 690 and 318 bp.
Footnotes
Schadock, I., et al. (2015). “Simple Method to Genotype the ACTN3 r577x Polymorphism.” Genet Test Mol Biomarkers 19(5): 253-257.↩︎